Add to favorites
Nederlandse versie: Consejeros Gratis adviseurs Usa version: Advisors 4 Free Version française: Conseils Gratuits Versione italiana: consigligratuiti.it Belgische versie: gratisadviseurs.be Versión española : Consejeros Gratis Deutsche Version: Gratis Beraten
   Current location: Home » Science » Biology
Advertise on this site?

Biology

Ask a Question?

Ask a question about Biology online. You'll receive an answer of a Biology Specialist. Do you have a question over the topic Biology? Click here.

Become advisor?

 The topic Biology doesn't have an advisor yet.

Are you an expert on Biology? Become a specialist. Click here.
RSS about BiologyQuestions about Biology via RSS. Click here.
RSS about Biology on your site?Questions about Biology on your site? Click here.
Keep informed via e-mail about BiologyQuestions about Biology via E-mail. Click here.

Questions already asked in the topic Biology


Blue Bacterial Culture without X-gal?2012-02-04 16:43:02
how is loss of protein prevented frm kidney?2012-01-19 16:52:26
Can mucus go inside an inflamed cell to trap dust?2011-12-11 14:49:58
plant organs and animal organ systems make what?2011-10-16 02:09:46
how does the lac operon work in detail?2011-10-04 20:51:07
the level of organization for the urinary system?2011-09-08 17:27:13
what is the function of germ pore in pollen grains?2011-06-14 15:20:27
sir/ma'am just want to ask?2011-02-02 03:13:35
what cell organelle does that affect and why?2010-10-02 14:10:14
Biology?2010-09-18 16:32:39
Name the location of proteins synthesis.?2010-09-08 19:09:30
tell about any five flowers how many petals,stamen?2010-07-01 06:29:17
what are the initial concepts of living organism?2010-06-19 03:07:25
quetion is given below?2010-05-27 07:07:48
What to analyse when extracting DNA from a banana?2010-04-21 03:07:58
genotype and phenotype question?2010-04-15 20:50:06
Name an animal which drinks water after a year?2010-03-30 13:56:00
what characteristics all the 6 kingdoms have in?2009-09-23 18:00:44
multiple epidermis on dorsal &ventral side of leaf?2009-09-16 15:24:18
Need help identifying unknown microbe?2009-04-29 22:44:22
AUGAAACGGGGACCAAUCGAUAACUUUUAA?2009-04-15 18:52:42
which of the following is likely to occur in Ecoli?2009-03-20 14:22:55
to which phylum does the tsetse fly belong?2009-03-06 19:34:13
what does the 6 kingdoms have in common?2009-01-08 14:12:23
Hydroxyl radicals?2008-04-13 16:27:10
the location of protein synthesis?2007-12-16 21:05:15



Disclaimer | Sitemap | Archive | Links | last 100 questions | Popular archive

Top 3 Advisors

Your advertisement here?

Concept & Web design Webshop+